Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:165-e7   

Cenix:165-e7RNAiCenix:165-e7
PCR_productcenix:165-e7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC42C1.5 Source_evidenceePCR601WS150 Sequence/Annotation Release
Overlaps_Gene C42C1.5 (3)
Overlaps_transcriptC42C1.5 Source_evidenceePCR601WS150 Sequence/Annotation Release
WB_DNA_textTH:165-e71043gttgccaattgactgcaaaaaaaattgatgaaatttaataattttatgtagcacaataaattttgaaccatgggcgcattgccgaccaacaattctagaaaatgagccggggtggcatcaatatttttaatcaaaatttaaaattgaaaatagactttatttcaatttgaaaaatcgaaaaaagtgctccaaaattgtctggagttgaaaattactggaatactggaatatagataatttgaagaagttttttcggtaagtttcaactgaaataaaagctattttcaaatgaagcaattctttttccacactccatcactaaattttaattttaaaaaaattgattccacactggctcattgtgtagaaatacaggccggcactagctgacaagatcaactcataccgaatcggaaagaattgtcgagtgcaggattcgaactccaccttcgatcttcacacgtggaccaataacgacatctggcccaatcacacaattttctccaacagtagccgatgggtcaactgaaaaattgaacaaaatatttaatttctgctaattaattcatttacccatcacatttccacgaatagtagctgttggatgtatgtttgatcctgtttcgagtttatcggattttgtagtatgacaatgatttaggaaaagggacattcctttgagaaaatctttcggttgacctacatccatccaaaagccaggaagtacaaaagcgtacaaatttccagagaatgccatttcggggaaaatttccttctcgatactagtaggtttcagtgggatgcggtcgagaattttggagctaaaaatgtagagacctgcattgatcttgttaccaacgtattcctgtggtttctccacaaaatcatcaatttttcctttatcttgatcgaaaactactactccatatttcgatggttcttctacttttgtaacggcaattgttccttcttttccgtgattcttgtggaattcaaccatttgtttgaagggaaaatcacaaattacgtcgctgttcaaaacg