Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:166-c11   

Cenix:166-c11RNAiCenix:166-c11
PCR_productcenix:166-c11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST01G5.5 Source_evidenceePCR310WS150 Sequence/Annotation Release
Overlaps_Gene T01G5.5 Source_evidenceePCR310WS150 Sequence/Annotation Release
Chunk_score Abs_score286
Max_abs_score286T01G5.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1513448415135523
Overlaps_transcriptT01G5.5 Source_evidenceePCR310WS150 Sequence/Annotation Release
WB_DNA_textTH:166-c111040ctccaaaacaaccagccattgcgcctgaaaaatcgaataaattttagtcaccgaaaatacatagtactaaaataaataaataaatttaaaaggtagagtacccaattagagaaaatagtttgaaatcactgattaaaaaaacctttctgtataaatattgttgatatttcagtttgaagcatggcactagtcttttcaaaaagcacaaacttctcctaaatttcccaatttactgaatcttcaactcaaattttgaaaaaccttaattaaaaaatctagccattgaactttgattcaagtttttattctggctcaacatagtccaaaaaacttacatatcattccaccagccagatcaagagacatatctcgacctctaagatccattaccataaagaatgcactttcataagtatgaataaccggtcgaatgaaaatatccattaatgaaaacattatggaacaacagcaaaaatatatcattaggtgcctgtagtttcccattttctttgcagattttgtaattatgagggttataagcagagagtttatgaaaacggataagataacagaagctatttgtgtggaagtcttcaaagtcttaaaagtcgttgggctcatattgctctgtaatagaaactagattactgaaaaattgtaaagcaaattccaaggaaaaaccacaataattcactgattgcaaagaatgatcaaatgaacatatgggcagagcaggagtggggcggtacttggttcaagcaggtgagaaaatatgaacagacgccagtggggagactagatattttaagattattttttttgctcaactcccacgaggacttttgaaaacgtgtaaactgaaagtgcaaagtatagaatgcactaaacgttttttgaagaaaaaacgaatactctagacaataaattgcttttccaagatttagcgatgagtaataaatattcgaataatttgaaacttgaaaaggttttgcccatccttaatcccaaatttctgcacattctgaaagttgatcggcatg