Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:166-e2   

Cenix:166-e2RNAiCenix:166-e2
PCR_productcenix:166-e2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF28F8.5 Source_evidenceePCR310WS150 Sequence/Annotation Release
Overlaps_Gene F28F8.5 (3)
Overlaps_transcriptF28F8.5 Source_evidenceePCR310WS150 Sequence/Annotation Release
WB_DNA_textTH:166-e2334tttttccagaatcccaccacgtacatgtttactgcagacttctgcgacttccttaacatgattaagtgttgatggtggtggaacgggcgctttaaccgatacattcgtcagcagctgacaccaatgcatcataagcgaatcgattgcgtcgcccagataagttggctcgatcggctcttcgtcatcctcgttcgttgagccggctccatcatttctcattcgtctttcgtcgttttcaatggatccatcagcggctccttgtggaacactattcgagtattcgtcgtctggaagatccggagcatcgccgagaatatcgtcaatgtcctcaccg