Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:168-g11   

Cenix:168-g11RNAiCenix:168-g11
PCR_productcenix:168-g11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY40B10A.2 Source_evidenceePCR290WS150 Sequence/Annotation Release
Overlaps_Gene Y40B10A.2 Source_evidenceePCR290WS150 Sequence/Annotation Release
Chunk_score Abs_score248
Max_abs_score248Y40B10A.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV20602672060999
Y40B10A.8 Source_evidenceePCR64WS150 Sequence/Annotation Release
Overlaps_transcript Y40B10A.8 Source_evidenceePCR64WS150 Sequence/Annotation Release
Y40B10A.2 Source_evidenceePCR290WS150 Sequence/Annotation Release
WB_DNA_textTH:168-g11733tctcggaattttgtgttcccgtaatatggcaacaactttttttttgcattttttcagaaaaaaaccaaaaaatcgatattttcagcgtttctggcaaaaaaaattttttttgctattttttcagaaatccgcagaaaaaccccggttttcaagaatttttcgattttttaaaattcaatttctcctaaaaacattttttttaaactaaaaatggctgattttgccgccaaattcccaacgagacccatgacttagtgccgtggagcgcgttttcacttgtaatattctagacaagctcatcgccgacggacaatctggaacctttgattttgccttcatcgatgccgacaaggtgaactacagtaactattacgatagagctgtcaccctgctccgcaagggaggtgtcatttttgtagacaatgtaagtagtggagcctgaattaaaaaaaaatttttttttctaaaatttcttgaattattcagagtctttggaacggatccgtgtgcgatccagcgagaagaaccgagccgagcaccgtcgcgatccaccaggcaaatgacaaaatcttcaaggatgaccgtacctattctgctctaatcaaccttggcgatggaactcatatcgcttttaagaagtgaattaggggctttttttttaattttgaattatatttaataaattttatcttttaaaaaattaaaaactacattgggggcaaagtagacaaaa