Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:169-b6   

Cenix:169-b6RNAiCenix:169-b6
PCR_productcenix:169-b6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY47H9B.2 Source_evidenceePCR68WS150 Sequence/Annotation Release
Overlaps_GeneY47H9B.2 Source_evidenceePCR68WS150 Sequence/Annotation Release
Overlaps_transcriptY47H9B.2 Source_evidenceePCR68WS150 Sequence/Annotation Release
WB_DNA_textTH:169-b6463aagggtatttgtttcgtgcgagctctcctgtacgtctttcgcttgctttgtgtttttctgcctattttatgcctgccaacttcatgcctgccaccgcctacttgcccacgtacctaccttgcgcctgtcttgtacattcttgcctgcgaggctgcctattttatgcctgcctacctgatgcctgtttcacgcatgcttgcctacttaccttccttccttttttgcgcatatttctatattcttgcctatttggttgtctcagaagcctgcctattttatgcccgttttccgccagccagcctaggttccttccttatgcatatttaccttatgcttgcctgcctacctacttgtcttaagcttgcctacctacacgcctaaatctatatttccagcaactattggaagccggaaatacccgtggtactacaaaatgagctcagcaatgtatccagcgttgtgc