Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:170-e12   

Cenix:170-e12RNAiCenix:170-e12
PCR_productcenix:170-e12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y63D3A.5 Source_evidenceePCR530WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRI1410314214103671
Overlaps_transcript Y63D3A.5.2 Source_evidenceePCR530WS150 Sequence/Annotation Release
Y63D3A.5.1 Source_evidenceePCR530WS150 Sequence/Annotation Release
WB_DNA_textTH:170-e12530atctctcggctccaaaacaatctcaccacgacaatattgtgttccaaaagagcttcgaagcggctccaccatcgccagtgccttccgagaaggccgagctcccggcgacgatccaaccgtcggttcacgagcaattcaatcatcgcccggcgcacgttgaggaggagattccgttggagaatcactatgctccaccaccacatcagcaaattcccgatgatctgaacactagcttcagctcccagccaccgccaccaattgagcaattcggagcgattccgccaccgaacgcgacgatcccgtcgttcccaacgtcgaatgcggcgagcccaccagttcaggagtttgctccaccgcctccacagcagcagcagcaacaattccaggctccaccaccaccgatggcgtcgcactcttcgatctcgtcgactccagtgcagcagcaaggatttgctccaccgcagcagtttggcgggccaccaccgtctggaccaccatcagagtatggaggatatgctccaccacagcag