Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:170-f8   

Cenix:170-f8RNAiCenix:170-f8
PCR_productcenix:170-f8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY57G7A.5 Source_evidenceePCR318WS150 Sequence/Annotation Release
Overlaps_Gene Y57G7A.5 Source_evidenceePCR318WS150 Sequence/Annotation Release
Chunk_score Abs_score255
Max_abs_score255Y57G7A.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII12730301273779
Overlaps_transcriptY57G7A.5 Source_evidenceePCR318WS150 Sequence/Annotation Release
WB_DNA_textTH:170-f8750ttttcggttggaggtttttgaacacttttcttatcagttggtcaacttccaaaacagcaattttccaatttttttttcgcatttctatgtttttttttctatgtatatacttcatttttgtagggttctgttaaagtatcccaaaaaaatttcaaatcttcatttctacagttcaagttctaattaatcacgtttcattgggggaagagtgtccaaaaagtcctggagcttcttggcggggagctgaaaattaaaaatgttttattgaaagtttatgcaaaaaaattacatctttcatgaccattccggttactttttcacccaatttctgcacgggattcatcaaattcggaaaatgatcacagtttgggagttgcattttgagaatctccagctcccggttcacacggacaatttgggtggcgagctgcaaaaaaattcaaattttcaggccaaaaaccaaaaaaaaaacctccgtttccagcggcttatacggtttaacgataaaattggcctcaattcccgaagttttactggttaccgaggagactggcccaacgtccactgtcaactcggagcgaagagatctgatctgaaaaattggaaaatgagggggttaaacttaattttagacaatttttaatacaaaattcgagttcagctgccttttttacccctatcccggcacttttcgcgcgattataaaaacctgtgcattttgtcgtaaggtcctgggtgtttgcgtacttt