Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:173-e11   

Cenix:173-e11RNAiCenix:173-e11
PCR_productcenix:173-e11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC35D10.16 Source_evidenceePCR510WS150 Sequence/Annotation Release
Overlaps_Gene C35D10.16 Source_evidenceePCR510WS150 Sequence/Annotation Release
Chunk_score Abs_score426
Max_abs_score426C35D10.16
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII48786214879533
Overlaps_transcriptC35D10.16 Source_evidenceePCR510WS150 Sequence/Annotation Release
WB_DNA_textTH:173-e11913gtaatgagcgcaacactccaaccatatctggaggccgtgcgtcacacgctccaggcagctctctgtcttgagcaattcagttcgcaggtggtcgagagacacaacaaaccagaagtaagatttataacagtaaaatgacttgcaaagtgtgaagattgaataatttaaatcagtccgccgccaattgcaatagtttttcgctcaaaaactatttaaatgtattattctatttgtatattataataaaattgtaggtggaagttcaaacatcgaaagaactgctcatgacgccagttgttgttgctcgaaacaaacaggaacgagtactcatcgaaccctccgtcaattctgtcagaatatcaatcgccatcaaacaatccgacgaaatcgagaagattctgtgccacaagttcactcgattcatgtgccaaagagccgataacttctttgtgctccgtcgcaagccactgccaggtcagaattaatactaatattcagagattaaagcgataattttaggttatgacatctcgttcctcatcacagcatctcacacagaagcaatgttcaagcacaaacttgtcgactttttgcttcattttatgcaggaaattgataaggtgaacattttaagttaatttttaaaaaattccataaatttccaggaaatttccgagatgaagctgtctctcaacgcccgtgcccgtgtttctgctgaagaatttttgaagcgtttcaattaattttctccccatgattcccaattcatttttctcattttcactcaaattccgaagactttaaactattatgtgaacacggttttttgatcaatttgtgtaaatatcatctttattctcaattttttcactttttgtttctgaaaatgactcccctcccaaaaatttcctgt