Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:176-b9   

Cenix:176-b9RNAiCenix:176-b9
PCR_productcenix:176-b9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST12A2.9 Source_evidenceePCR760WS150 Sequence/Annotation Release
Overlaps_Gene T12A2.9 Source_evidenceePCR760WS150 Sequence/Annotation Release
Chunk_score Abs_score702
Max_abs_score702T12A2.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII62535916254684
Overlaps_transcriptT12A2.9 Source_evidenceePCR760WS150 Sequence/Annotation Release
WB_DNA_textTH:176-b91094cataaccaacggggatctgtaatgagaagtttttaatcagaatgagcaacgcaactaacccaacatttagaacatcccatgcaaatggctgcacaagataagccaaccaatgttttccccaatcagtattaagaactttcatagcctcaaaaacagcaggaaccaaaaaacaaatcgaatttgctgcgcatgctttacacaaggttccctctgattttttcaatctgttcttcatatgggacattttccaaaatgttattgatgtagtaactacagtaatcataactactgctgaccgaattataaatagaaacagagacatactggcccatgggattatttttaagtagttgatgtagaatcctccaaagtaaaatattaaaactttcttcgatattattgtattccaaatgaagaagaacggagcaatcaaattcagaattaatattctcgaaaagtttatcttccaaaatttctcgtgatctacaggccataatacagatgacattcgatttgtggtgagaaagatttgaataaatggttgagcacaatgaagatagttgagcagtggatagtaaagttccataagaaatggattcgatatgaaaaattgagcagctgggaggcaaagttgtggtacgtagacaaatagtctagtaataaaaatgtcaagtaaaactaaaattagtccctgtaaactttgactataatgaaattcggaagaaaaatgtaatgatgtaactgtttttaagtttaactatcgcctcatcaagaaacccgcaaaaatttacactcttcaagtgtactactctccgctattaattgtcatagtaattatctaatgactgtaagagcactgtagggttactgtagtttgtttgttcagtaatatcaaagacatgttaggaagagtaacaaataacatatttcccattgtttttttaaagtttttttaattcaagaaattactctgaaagcttaccaccattgaataaaccataaaaaatggatgatacccatatgatttcttatgttgcacccacacaacatacaaaattctagagtaaagaaaaactgctggggctagataagca