Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:178-b12   

Cenix:178-b12RNAiCenix:178-b12
PCR_productcenix:178-b12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY71H2AM.17 Source_evidenceePCR355WS150 Sequence/Annotation Release
Overlaps_Gene Y71H2AM.17 Source_evidenceePCR355WS150 Sequence/Annotation Release
Chunk_score Abs_score313
Max_abs_score313Y71H2AM.17
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII27675532768451
Overlaps_transcriptY71H2AM.17 Source_evidenceePCR355WS150 Sequence/Annotation Release
WB_DNA_textTH:178-b12899tttctctcgctttttccagctttgtcagtattttcaagttaaaatgagcaatttttgctcaaaaattaaattttttgtgactttcgcgtaaaaaatccacttttcaaacggtttttgtctgaaaaatttaattttcattcgaaaaatcaaaattttccgaattttcgtagctcaaattctcgttttaatggatttttctcgcttcttcccagctttttcagtgttttcaagtcaaaattagcattttgtgtgcaaaaaatccaattctctgagatttttgctaaaaataagcaatttttaacgattttcgtttaaaaattcagtttttacgattttgttgctgaaatgctcgctttaatggatttttcccagctttttcagtattttcaagtcaaaatgagcattttttgtgcaaaaacccaatttttcaggatttccagaatcccttacagttcttgtatcagtaacgatgctcggcgagaacaaatcactaatcaatcgattatttcgttcaaatctgacacccgcaagacgtcgggtgctcaattcattgccaccgtcatcctcgtcaaccggttgaattacaactccgccagcgtccattcggcttctcgacattttttcgttgttcttcgcgcgtccctggaagaaaatgtatttaaaaatgtatttttcggctgaaaaaagtcactttattaatcataaaattggaaattccgtttccttggaaatgtttcatttgtttttcgtagtctgcctgaaaaataatcattttttacgggaatttctcgttgattttaactttttcaagctcatattcatgttgataatgcgatttttcaccgtccggaaggtccaaccaatactttccaatcatttttccaatatcccaaagctgg