Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:178-c1   

Cenix:178-c1RNAiCenix:178-c1
PCR_productcenix:178-c1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y50D7A.7 Source_evidenceePCR323WS150 Sequence/Annotation Release
Chunk_score Abs_score281
Max_abs_score281Y50D7A.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII295531296034
Overlaps_transcript Y50D7A.7.2 Source_evidenceePCR272WS150 Sequence/Annotation Release
Y50D7A.7.1 Source_evidenceePCR323WS150 Sequence/Annotation Release
WB_DNA_textTH:178-c1504atcgaaattcaattcggcaggcgaaatactagtttttctacaaaaattgaattttctgagcttttgagctagattccggcatctgagccaatttttgagcttctgaacgattattttttcaaaaaagtttatttcttcaagtttcaaaatccaataataataaaaaacgaaacaatgattatctacaacttgcaatgcggtgatccaataatatcaattaagttagcactggcgaagatgttcgccggatccagctcactcttgatagccttcaacaacgcaattccgactgctccgttcgtggtcagcatccattgttttctgatctttccgactccgtggtgatgtgagatgcttccaccgcaagcgatgatctcgtcacgggcggctgtctggaaataagggcaattccgagatcaggggcgttttatcgaaagcttacctcaatacgatcataaacttctaggccatttttcaatcctctggcgttgaatccgaaataga