Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:178-f3   

Cenix:178-f3RNAiCenix:178-f3
PCR_productcenix:178-f3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y54F10AM.8 Source_evidenceePCR690WS150 Sequence/Annotation Release
Chunk_score Abs_score627
Max_abs_score627Y54F10AM.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII25054162506297
Overlaps_transcript Y54F10AM.8.2 Source_evidenceePCR690WS150 Sequence/Annotation Release
Y54F10AM.8.1 Source_evidenceePCR690WS150 Sequence/Annotation Release
Y54F10AM.8.3 Source_evidenceePCR690WS150 Sequence/Annotation Release
WB_DNA_textTH:178-f3882gcaaattgtctggccttgttgtcaaaaccggagatctcgctgacttttggaaggaatggaatgttgtaagaggcgaaataggtgtacttcttcaggtaccatgtcatgtcacgggtctcgtagtagccactgaaattttgagggattactgcttgtttgcttaggtgcctactcacggtgtctgctcggaaatccaaagaacatccttgtcggggagctccttctcaggagtgaattgtttccaatccaacaccgtccactgattgttataggttcctgaattgtaccgtccgaacatgtcaacccattgtttcccggttcttgagagcaagttcgagatcatcgatcggatccagcagtgaacttgtccttctggtttcatgaacttgtcagtatacagggtttggttgaaaatcgcaattgtcgtttcgatagaggtctgtaagatcataaatgcataggcttcaggcaggcatgcatgcctacacagacccacttaccaatccagcagaggtgatagtgtagtcatcggtggaaatcaatactcccgggtacccggagaaagtaacaatatgcccgggaacctcgttgacgtcatatccgaacttgtaaattttgagaactctctgcatccaactgagagaagacattgagacatgagccatgaacatgtccttgttccctggagcaagtttgacgaatccggagcatcttccaccttctgggtactccatcgggtcggcggttttgttgagaagcttgttcaggtcaaacatatctccggctagttgcatcatgctggaagatttatcacgtagtgagtatagaaaggtctcgtggcctagaaaccttggcggtcgcgcttaggaaaggcgtgacgtc