Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:179-e8   

Cenix:179-e8RNAiCenix:179-e8
PCR_productcenix:179-e8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene ZC262.8 Source_evidenceePCR547WS150 Sequence/Annotation Release
Chunk_score Abs_score463
Max_abs_score463ZC262.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII83308718331750
Overlaps_transcript ZC262.8.2 Source_evidenceePCR496WS150 Sequence/Annotation Release
ZC262.8.1 Source_evidenceePCR547WS150 Sequence/Annotation Release
WB_DNA_textTH:179-e8880tgaattgcaataaagcggaaataacaacagataagagatattgaaaatgttttaaaacatttcgaaacaacgatggaaagttcgaggatcggaaaaattctttagaaacaaacaaaacaacagaataatattgagctaaaaaaggataatatctaaataaaatctaacaatttcaattgagtggattcttgaagagttgttgattcttcgtaggatatctgaaaaccaaaaaataatttgaatattaaatttttcagtgcaaaaccttttaatataaaaccatgttccatgtcgttgtttcgtctccaattgatacattgacatatcatctttccagtatcgattgaatcgtttataacctgctctatccgcttctgtgccatatttatcaccgaaaagtccagaccagaatgcttgcattacacatcttcaaataattatttgcatgtaagcaacagttagtttcttttaattacctttccattctcaattgttgtttcttacaaagcccggtgagttgacgtggaagaacagttccatcgtctctcatgaattgttccaagatcagaacatctctgaaacgattaaaataacatttttcaaattgcggaaagaaaaaacaagtaatttttcaaacaacttacttataagtgagcttaattggcacgttgcatgtgcacagcgagcacaactcgtcatcttttcgtgctccacgcgagtccgtcaccttttccattgaaatatacgttgttccctcttttttatcttctttcgctgaattattaaaagttattacatgttagcaaatgaacaaaataaacgaactctgaaatttatgtccagcggctcctgatgctgtcgattgtaaccgtgaagccgt