Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:179-e9   

Cenix:179-e9RNAiCenix:179-e9
PCR_productcenix:179-e9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK328.8 Source_evidenceePCR465WS150 Sequence/Annotation Release
Overlaps_Gene ZK328.8 Source_evidenceePCR465WS150 Sequence/Annotation Release
Chunk_score Abs_score402
Max_abs_score402ZK328.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII60257796026677
Overlaps_transcriptZK328.8 Source_evidenceePCR465WS150 Sequence/Annotation Release
WB_DNA_textTH:179-e9899gaactatgtgaaaccggggattataacggtgcattgaattgagtacaatctgaacatttaagatgtataatttttgtttctttcatcatgaaacttacatgaccatcattattaaatggattatttgaaagtttagccattttgaagtcaactccatctgtcatccaccattcaccacttctaggtgattgtggatgtacaaaacatgtcggaagtggatgatgttctccaactccagcaactatccagtttccattccaaaatttgtaacgaagtttatctactgatatcatttccattattattgtgtagttgctgtttttgtctaaaccacttaatttgagcttcaccagcgggaacattcttctgaaaatgtcaattttaaaatcaatacgcattttttatcccttcaaagaatttttatttgaaaacactgtaaatgtgtgaaaatgttctgaaaaattacacaattttcagtttaaagataatttgttttgttgaacttttcagttaatgacagaaaatataatggaagcttaaatttttgaagtttgttgaaattaaattgaaaacatctatcataaaaaaatgtttttgaggcaatcgatgtatatctctcaaaaatgttttattgcaacagtgagaaaaatagtagatgccgagatttttctgacaaaaataaattcaaataaatttcaagcattatatattgtcaggtcaaaaaatcaaaatataccaaacaaaagctaaccttcctttcttcgtgataatcatttcggttccacattccaaaaaagtgctccataaatttctatttaccagctcaacatttgggttatcgataactccatcatctttttttctgtcaaaaaacgctgaggacgctggaaaagaaaaga