Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:18-c4   

Cenix:18-c4RNAiCenix:18-c4
PCR_productcenix:18-c4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F10G8.3 Source_evidenceePCR573WS150 Sequence/Annotation Release
Chunk_score Abs_score552
Max_abs_score552F10G8.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1002791010028482
Overlaps_transcript F10G8.3.1 Source_evidenceePCR573WS150 Sequence/Annotation Release
F10G8.3.2 Source_evidenceePCR573WS150 Sequence/Annotation Release
WB_DNA_textTH:18-c4573gttgtcggaacacatgatggaccagtgaagacttgtcactggattaatggaaacaactatcagtgtctgatgaccggatcattcgataaaactcttcgattttgggacatgaagaatctaccaaatcagacacaaatggcacagattcaattaccggaaagagtttatgcagccgatgtgctatatccgatggcagttgttgcactagctaacaagcatatcaaagtttataatctggaaaatggaccaacagaagtgaaagatattgaaagtcaattaaagttccagatcagatgtatctcaattttcaaggataaatcgaatcaaaatcccgctggattcgctctaggatctattgaaggtcgagtagctgtacaatacgtggatgttgcaaatccaaaagacaacttcacattcaaatgtcatcgatcagctgaacttgtgaacggatttcaagaaatttacgctgtcaatgatatttgcttccatccacaacacggaactctggtcacaattggttcagatggccgttattcaatgtgggacaaggatgcacggacaaagctgaagaca