Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:18-d7   

Cenix:18-d7RNAiCenix:18-d7
PCR_productcenix:18-d7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K02F2.2 Source_evidenceePCR514WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRI68369876837500
Overlaps_transcript K02F2.2.2 Source_evidenceePCR514WS150 Sequence/Annotation Release
K02F2.2.1 Source_evidenceePCR514WS150 Sequence/Annotation Release
WB_DNA_textTH:18-d7514ccacaatacctcgctggaatccgcggactttccgaggagaccaccactggagtccacaacttggctaagatgctcgccaagggagaccttaaggttccagctatcaacgtcaacgactctgtcaccaagtccaagttcgacaacttgtacggaatccgcgagtctctcccagacggaatcaagcgcgccactgatgttatgctcgccggaaaggtagccgttgtcgctggatacggagatgtcggaaagggatctgctgcttccctcaaggctttcggttcccgtgtcattgtcaccgagatcgatccaatcaatgctcttcaagccgctatggaaggatacgaagtgaccaccctcgaggaggctgcaccaaaggctaacatcattgtcaccaccactggatgcaaggacatcgttaccggaaagcacttcgagcttcttccaaatgacgctatcgtctgcaacgttggtcacttcgattgcgagattgacgtcaaatggctcaacaccaatg