Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:180-c4   

Cenix:180-c4RNAiCenix:180-c4
PCR_productcenix:180-c4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y22D7AL.10 Source_evidenceePCR272WS150 Sequence/Annotation Release
Chunk_score Abs_score230
Max_abs_score230Y22D7AL.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII16181531618922
Overlaps_transcript (2)
WB_DNA_textTH:180-c4770ccgattttcgtccaaattgtgtgaaatttcaacggaaattcagattttcacattaaaaattcgccaattaatccatattttcgctcgaaattcgtcgcattttgtaccttggtgcctccgtattctgggagaaggacacgatctcctggcttcacagtcaatgcgacgagctctcccttctcgttgcgaagtccggctccggcagagacgacggtggcttcaaggacctgaaatattcgaaaattaggtggaaattgctttaatttgagtgaaaattcggtaatttcggataaaaattggacaaaaacctccgcgagcagtcggagagcgtgttggcagggaaaatcgataattgcatcattacaccagactttacggaattttcggtgaaaattaacatttttcgtataaaattgaaggtttttagctagaaactgtgttttagacgccaagttgcaccattttgacggtgaaattggcatttttgtgctagaaatctgctccaagacgttgaaatttatcagttttcacctgaaaaatcaatttttaggccaaaaattgctcacttttccctgtgacttctccgggagcatgattcctccctttgtcttggtctcggcggcgactctctcgacgagcacacgatcatagagtggcttgaaggtcttgaggacattgctctgcaaaaaaatacgcgtttaattcggagaaaacaccgggaaaatagcttaccgatcggcggacagcggtgaggaacatttttcggctga