Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:182-c8   

Cenix:182-c8RNAiCenix:182-c8
PCR_productcenix:182-c8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C47B2.3 Source_evidenceePCR150WS150 Sequence/Annotation Release
Chunk_score Abs_score129
Max_abs_score129C47B2.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1296513912965288
Overlaps_transcript C47B2.3.2 Source_evidenceePCR150WS150 Sequence/Annotation Release
C47B2.3.3 Source_evidenceePCR150WS150 Sequence/Annotation Release
C47B2.3.1 Source_evidenceePCR150WS150 Sequence/Annotation Release
WB_DNA_textTH:182-c8150ttgattccgaccttgaatccggttgggcaccaatcgacgaattggatggttctcttggtcttgattgcagcgatggcggtgttaacgtcctttggaacgacgtctcctctgtacaagaggcacacagccatgtactttccgtgacgtgga