Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:183-g9   

Cenix:183-g9RNAiCenix:183-g9
PCR_productcenix:183-g9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF21C3.5 Source_evidenceePCR109WS150 Sequence/Annotation Release
Overlaps_Gene F21C3.5 (3)
Overlaps_transcriptF21C3.5 Source_evidenceePCR109WS150 Sequence/Annotation Release
WB_DNA_textTH:183-g9109aaactcaagccgtttctccacagtcgatcgagcctcctccaaatcttgacgaacaagaaccgctccgatgagtttgtagactttcgagtcggattccatcagatcaagc