Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:184-c10   

Cenix:184-c10RNAiCenix:184-c10
PCR_productcenix:184-c10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F46A9.5 Source_evidenceePCR148WS150 Sequence/Annotation Release
Chunk_score Abs_score127
Max_abs_score127F46A9.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI94719329472079
Overlaps_transcript F46A9.5.3 Source_evidenceePCR148WS150 Sequence/Annotation Release
F46A9.5.2 Source_evidenceePCR148WS150 Sequence/Annotation Release
F46A9.5.1 Source_evidenceePCR148WS150 Sequence/Annotation Release
WB_DNA_textTH:184-c10148tgcctcgattctgaagaaggtcattagttggtgcaaccatcatcactccgatcctatctcgactgaagattccgataaccgcgagaaaagaactgacgacataggcagctgggacgtcgagtttcttaaggttgaccaaggaaccctt