Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:188-a1   

Cenix:188-a1RNAiCenix:188-a1
PCR_productcenix:188-a1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW01A8.4 Source_evidenceePCR150WS150 Sequence/Annotation Release
Overlaps_Gene W01A8.4 Source_evidenceePCR150WS150 Sequence/Annotation Release
Chunk_score Abs_score129
Max_abs_score129W01A8.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI70683987068547
Overlaps_transcriptW01A8.4 Source_evidenceePCR150WS150 Sequence/Annotation Release
WB_DNA_textTH:188-a1150aaaacggttccgacgtacaggaatacggtgcgtggtgtgaaacggaagaactcggcttgagtcatatcagcagaataccaacggaacattgctggatccatggtgactccctccttgtacttgaagctatgaggatcgtattcacgacgg