Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:189-h3   

Cenix:189-h3RNAiCenix:189-h3
PCR_productcenix:189-h3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y39G10AL.3 Source_evidenceePCR139WS150 Sequence/Annotation Release
Chunk_score Abs_score118
Max_abs_score118Y39G10AL.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI22876022287740
Overlaps_transcript Y39G10AL.3.2 Source_evidenceePCR139WS150 Sequence/Annotation Release
Y39G10AL.3.1 Source_evidenceePCR139WS150 Sequence/Annotation Release
WB_DNA_textTH:189-h3139ccagaagcatttgcatcgtaatatttttgatatgtgctggcattagaataatttctttatccttaatcacatgttcgagatctgtatccataaagtcgaaaaccagttgaatacttgttcgatgtccaatcacatctcg