Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:19-b5   

Cenix:19-b5RNAiCenix:19-b5
PCR_productcenix:19-b5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF22D6.6 Source_evidenceePCR641WS150 Sequence/Annotation Release
Overlaps_Gene F22D6.6 Source_evidenceePCR641WS150 Sequence/Annotation Release
Chunk_score Abs_score557
Max_abs_score557F22D6.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI70964637097247
Overlaps_transcriptF22D6.6 Source_evidenceePCR641WS150 Sequence/Annotation Release
WB_DNA_textTH:19-b5785gagacaattccgaacgaagcactcgaaattcatcgttcatttccaacagattggaaaaagacgagtatttctgaagatcaaatgaaagaagagaaagagaaagctcttttttccaagaattcattgattccagaaatggaacacagcgattgggatccacgacagaattcaatcgaaatgttatcgattgatcaattggaagaaaagttagtaaatagaaaataaacttttggttttaaaactttaacttttcagatttaaatttccctatgattcggatgtagccccagctatcatgcttgcagttgaaggaagatgtacaaaaagtccatttgagtggtatgcaaggccgattgtaaagttagtacattgattgaatattaattgttatttgacgttattttttaaagaactggaagaaatgcgaatggcgaaatggttatttggaacgatgaggaacaattgaaggaagtggatccagttgattggatgatttatggaaatgatcaacttttgagtatggcagagcaattggacacttattattcaaatcctaaaaatagaaaaccattgaaagcggaagaaatgtaattgattagaaatttaatctcgagtttaatatttattttcagtcaatcaatgagaaaagagaagcgagacgtgtttgctgtatgtgcagtaaatgaagaaaaagcaatgtacactggagagtggcaaagagtccttattgtagaatgtgacacttttgctgaagttcgttttctggattcaggcggtcgtgatat