Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:19-h3   

Cenix:19-h3RNAiCenix:19-h3
PCR_productcenix:19-h3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C47E12.4a Source_evidenceePCR650WS150 Sequence/Annotation Release
C47E12.4b Source_evidenceePCR650WS150 Sequence/Annotation Release
Overlaps_Gene C47E12.4 Source_evidenceePCR650WS150 Sequence/Annotation Release
Chunk_score Abs_score549
Max_abs_score549C47E12.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV99960159996773
Overlaps_transcript (8)
WB_DNA_textTH:19-h3759tgtaattgcggaaccattcaacagatgcctgaaagaaaaaaaatgaaacgtattttgaaaaatgtttaatcgaaacttacagccaatagtccaggataaaccttttcgacgtcatcaatgtcattcaacttgtcagcattctcatcgttgacatcaattgcgaccaatttccaatcggtctctccttcgtcaatgagagccaatgttccgagaacttttacttgcagaacagctccccgtccggcaacctttgatccaacttcaataacatcaattggatcattgtctcctttagctccagtgtcaggaacaacatggtttggatcttcccatgtctgtggaagagctccgtagttccagatgtatcctttgtgtgggaaaatgttgtgaacaaagcgagctacacccttcttctcatcttgcttgattggcgagaatggttccttggtggccatttccattttagcatttgtccaacgtggaatctcaacaatcatgttgtaaactctcttgtccttgttggcgaacaatggaatatcgtgccaaggagatacgattccttgtggtccctctgcaaaatagatattagaaccaataattatagcagcttcgactcactgatataaactctataatccaaactataaagagatccacgctcgacggcttcgtaaactgctgaatctccggctccggtgctcattttcacagcttgactttgcaaaatgacagcagtctccgacaagggcctgaaaaata