Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:191-g9   

Cenix:191-g9RNAiCenix:191-g9
PCR_productcenix:191-g9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y92C3B.2c Source_evidenceePCR146WS150 Sequence/Annotation Release
Y92C3B.2d Source_evidenceePCR146WS150 Sequence/Annotation Release
Overlaps_Gene Y92C3B.2 Source_evidenceePCR146WS150 Sequence/Annotation Release
Chunk_score Abs_score146
Max_abs_score146Y92C3B.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII10646261064775
Overlaps_transcript (7)
WB_DNA_textTH:191-g9150ctaccttcccaacacctggaaccggatgatcctcatacggtcttggaatttccaacgagcgaacaattccatattttgagcattcatcgcgtacatcctccagaatctcttcgtactcatcatcagctttcagctcatcctcagtcacca