Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:193-h5   

Cenix:193-h5RNAiCenix:193-h5
PCR_productcenix:193-h5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C25D7.12 Source_evidenceePCR148WS150 Sequence/Annotation Release
C25D7.2 Source_evidenceePCR148WS150 Sequence/Annotation Release
Overlaps_Gene C25D7.12 Source_evidenceePCR148WS150 Sequence/Annotation Release
Chunk_score Abs_score105
Specificity_index0.292
Rel_score0.827
Map_statusBest_ePCRV1503508615035233
C25D7.2 Source_evidenceePCR148WS150 Sequence/Annotation Release
Chunk_score Abs_score127
Max_abs_score127C25D7.2
Specificity_index0.354
Rel_score1
Map_statusBest_ePCRV1504111415041261
C25D7.14 Chunk_score Abs_score127
Max_abs_score127C25D7.14
Specificity_index0.354
Overlaps_transcript C25D7.12 Source_evidenceePCR148WS150 Sequence/Annotation Release
C25D7.2 Source_evidenceePCR148WS150 Sequence/Annotation Release
Overlaps_pseudogene C25D7.14 Source_evidenceePCR148WS150 Sequence/Annotation Release
Map_statusBest_ePCRV1503713015037277
WB_DNA_text TH:193-h5_1148ggggactgcaagaggtctaacgctctttgatttcgacttcttggattttgaaggctttccacggcttaagtgtccagatttggacgactttccagatctcgtcgacttcgcggatttttgactttttgaagcacgagacgacttggtt
TH:193-h5_2148aaccaagtcgtctcgtgcttcaaaaagtcaaaaatccgcgaagtcgacgagatctggaaagtcgtccaaatctggacactcaagccgtggaaagccttcaaaatccaagaagtcgaaatcaaagagcgttagacctcttgcagtcccc