Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:194-d4   

Cenix:194-d4RNAiCenix:194-d4
PCR_productcenix:194-d4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC50F4.6 Source_evidenceePCR150WS150 Sequence/Annotation Release
Overlaps_Gene C50F4.5 Source_evidenceePCR150WS150 Sequence/Annotation Release
Chunk_score Abs_score129
Max_abs_score129C50F4.5
Specificity_index0.5
Rel_score1
Map_statusBest_ePCRV95491719549320
C50F4.6 Source_evidenceePCR150WS150 Sequence/Annotation Release
Chunk_score Abs_score129
Max_abs_score129C50F4.6
Specificity_index0.5
Map_statusBest_ePCRV95491719549320
Overlaps_transcript C50F4.5 Source_evidenceePCR150WS150 Sequence/Annotation Release
C50F4.6 Source_evidenceePCR150WS150 Sequence/Annotation Release
WB_DNA_textTH:194-d4150gcttctcgcagttcttcgtcaagcaacaaatgccgagttcaacaaggtggccaaggagaagtatggagatgttccagaaggttcagatgatgacgaagagcagcaaacttcggagcagaataaggagcagcagcagtcatccagttcgaa