Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:198-e7   

Cenix:198-e7RNAiCenix:198-e7
PCR_productcenix:198-e7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK06B9.3 Source_evidenceePCR143WS150 Sequence/Annotation Release
Overlaps_Gene C36A4.4 Source_evidenceePCR143WS150 Sequence/Annotation Release
Chunk_score Abs_score122
Max_abs_score122C36A4.4
Specificity_index0.5
Rel_score1
Map_statusBest_ePCRIII38429573843099
K06B9.3 Source_evidenceePCR143WS150 Sequence/Annotation Release
Chunk_score Abs_score122
Max_abs_score122K06B9.3
Specificity_index0.5
Map_statusBest_ePCRIV41891544189296
Overlaps_transcript C36A4.4.1 Source_evidenceePCR143WS150 Sequence/Annotation Release
C36A4.4.2 Source_evidenceePCR143WS150 Sequence/Annotation Release
K06B9.3 Source_evidenceePCR143WS150 Sequence/Annotation Release
WB_DNA_textTH:198-e7143catcgaaatcgaatccatgatgagccgccagtttcttcacatgctcacgagtagcctcctctgttccaggtgacgtcataactgcccagtgaatttttcccggattctgatgctcccgttctccagcgagagcctgaagaagt