Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:20-b4   

Cenix:20-b4RNAiCenix:20-b4
PCR_productcenix:20-b4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF55C5.5 Source_evidenceePCR547WS150 Sequence/Annotation Release
Overlaps_Gene F55C5.5 Source_evidenceePCR547WS150 Sequence/Annotation Release
Chunk_score Abs_score486
Max_abs_score486F55C5.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1227336912273999
Overlaps_transcriptF55C5.5 Source_evidenceePCR547WS150 Sequence/Annotation Release
WB_DNA_textTH:20-b4631gtgaaatgaaccgtcccatcgggatatcatcagttccatctttaggatgtgaagctccaaacaaagttgttccttcgggagctttaaaagccttaactcttctcactgtcatgttctcaccaagctttccgattgaaagggagagcacttcacgcatattttttccgtcggaatcggtcagatccccaagatcataggtgaattcttgaagttttgagccgctcgatatagattgtggcttagcttttgcgagaacagagttggagatgtttgacaacaaatccttgaaagctccagatcgcgccacaaaatcagtttcacaactgagttctaccacagctgctgttgagttgtccgtgactacagatacaagaccattcgatgttacacgagttccaagtctggaatattctataactattaaaataattccttgtgaagtcaacattccaaattaaaaaaatttcaaaataaacacttactttgccgctttggcccatccttccttcgctgcagcttctttcaaccattttacagcactatccatatcattttcgccaaactgaataagtgctttacgacaattcacataactataaccagtcttttttcgaagagccattagagcctg