Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:20-f8   

Cenix:20-f8RNAiCenix:20-f8
PCR_productcenix:20-f8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T05H10.5 Source_evidenceePCR509WS150 Sequence/Annotation Release
Chunk_score Abs_score467
Max_abs_score467T05H10.5
Specificity_index0.5
Rel_score1
Map_statusBest_ePCRII80668758067462
T05H10.6 Source_evidenceePCR509WS150 Sequence/Annotation Release
Chunk_score Abs_score467
Max_abs_score467T05H10.6
Specificity_index0.5
Map_statusBest_ePCRII80668758067462
Overlaps_transcript (7)
WB_DNA_textTH:20-f8588aaacggaattgttggagcacaacagccacttggagctggagttgcattggccatgaaataccggtatgttaacaaattttgatgtatttttttacgagaacaactcatattttttcatctaaatattttattttattttcagtgaacaaaagaatgtatgtgttactttgtatggtgatggtgccgctaatcaaggacaacttttcgaggcgactaacatggctaaactttgggatcttcctgttctgttcgtttgcgaaaacaatggattcggaatgggaactactgctgaacgttcatctgcttctaccgagtattatactagaggagactatgttcctggaatctgggttgatggtatggacattctcgctgttcgcgaggctaccaagtgggctaaggaatattgtgacagtggtaaaggaccacttatgatggaaatggccacctatagataccatggacactctatgtctgacccaggaaccagctaccgtacccgtgaagagattcaagaagttcgtaaaacaagagacccaattactggattcaaggaccgtatcattacatcttcattggccacagagg