Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:200-a12   

Cenix:200-a12RNAiCenix:200-a12
PCR_productcenix:200-a12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene W07E6.4 Source_evidenceePCR525WS150 Sequence/Annotation Release
Chunk_score Abs_score462
Max_abs_score462W07E6.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII487106488570
Overlaps_transcript W07E6.4.1 Source_evidenceePCR525WS150 Sequence/Annotation Release
W07E6.4.2 Source_evidenceePCR525WS150 Sequence/Annotation Release
WB_DNA_textTH:200-a121465aaagccaaaagctgtggagaactggatcatttcaccgctcaccggagagcgtattccatcggataagctcgccgagcacgtcagatacaatactgtcgattcacagtataaagaggacagagatcgtcatattggagaaagaagcacggaggagcccgtattggctcttggagctgatatttctaggttaacatttcagaaatttctttgaaaaacgaacaaaagtctaaaaatcgccacaataatctacaaaaaatcgatttttcgtggaaattttgttcatttccgcatttttcgctcgaaatttgagatcagtgcttcaaattagacctggaaagattctagctcaatttcagaaaatttgggttatcgtagcaccagaagtactcaaacactgactacagcacacctaagcaccaaatttcacgacagtggtgaattttgagctaaaatcgattttcaggagtaaattagagtgctaaatctaaaattggaataaaaatgtcttaaaaattgtaaaaagtgaaaattaaagattttcagacaaatttccgattacaaatgcccacaaaagatgttcaaagctgaaaattatagattttcagacgaattttcatttttccacgtgccaatatcactaaaccccagttttttctttcagaaatcttggcaatttcgctgaacgtcgtacggatatcttcggtgtcggcggagagcagactatgatcggaaagaagctcggcgaagaggacaattcgcaacaagggcagaacaaactgatttgggatggaactgaagagactcgggatatgattacccgagctgtacagaataaagtcactttgggtacgggaaatctaattttttggcgaaaattttgagttttccgggattttgtttgggaaaattacacgatttgtgtggttttctatgtagaaatttctctaaaacactcaaatgtttcaaaaattcgagttttcatgaaaaaccagtaattcaaaaaaaaagcaatttcctctaacaaaaaccgtgccaagttttggatttatgatattttccatctgaaaaaaatctggtatctcggctgaaacgggcaatatataccgtagtccaagttttcccaaaaattccaaccaacaatttgtgcaataaagcacagttgccaccggagatgcaaaagctatgtttaattttccaatttttggctgaaaattgagctaaaaatttacaattttcccgtcataaaactcaccgaaatttcgcttttcagtgttttttatgcaaaaaaattaatcatttttcatttttcagaccaacaaatcaacgaaatccaccgtcaacacggattcgttgccgatccatcaaaggaaaagattggagctcagcaggtgccacgtcatcaatcgacccagggaaatgtgacaattactcaaggaataacgaatattcctggacaaatgccatc