Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:200-h5   

Cenix:200-h5RNAiCenix:200-h5
PCR_productcenix:200-h5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F13D12.7 Source_evidenceePCR783WS150 Sequence/Annotation Release
Chunk_score Abs_score679
Max_abs_score679F13D12.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1174362911744727
Overlaps_transcript F13D12.7.3 Source_evidenceePCR526WS150 Sequence/Annotation Release
F13D12.7.2 Source_evidenceePCR526WS150 Sequence/Annotation Release
F13D12.7.1 Source_evidenceePCR783WS150 Sequence/Annotation Release
WB_DNA_textTH:200-h51099gtaatatggggagggcgattgaagagagactagaaagtaccgaacaaaaagcgatgagaagaggtgagagaagaaaaagagatccgggcacgcggaagagggcgccgggatagcggatagcgacgaaagaatgagaacaacaggggggtttcaagagcggaaaaaaattggggaaaatggggaaaaaaattgccacgtagtgtcatcatcattcaatcaataattggagaataattaaggaagacatttgatgtttcttaattccagatcttgaggaacgagtcccatgatcctgtgcacacggccataccgtcctcggtgactcctagacaagaaactcggttatcgtgaccagccaatactcctgaaattggaagaacaattagtttttcatcactttcaacttggaaaatttcaaaaaaaggagctaaaggcactcaccagctctctcctgtcgcatcgaatcccaaacattgcagttgaagtcgtcgtatccggcgaacaacaggcgacccgattttgagaatgcgacactagtgattccgcaaataatattatcatgagaatacatggcaagttcctgatcagcacgaatgtcgaacaatcggcatgtcgcatcgtcggatccggtggcgaacgcgtttccggatgggaagaactgcaaaaaattgatttttttttgaaaaatcttcaaaataataaaacttacggcaacagcgttgatgtctgactcgtgtcctgggaacgtttgcttgcacatgccgtctcggatatcccacaactgaaatttaaaaaatttaaaaaaaaatcaacttttcaaaaatcctataccttcgccgaagcgtcacaggctcctgagatgaatgtgcggaagtctggagaaagtgaaagcgacatgacgtcaccagtgtgaccggtgaacgcggtgcactgttgtccggtttcaatgtcccatagagcgctggaaaaaaaattggagaattaggataatttacgaaaaagtgatattatatgatatggtagaggttaaaggcacatgccggtttgaaaagtgggtctcgccacgatcatagtggccgctacaggcgccaaatttctc