Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:201-a12   

Cenix:201-a12RNAiCenix:201-a12
PCR_productcenix:201-a12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK12D12.1 Source_evidenceePCR1170WS150 Sequence/Annotation Release
Overlaps_Gene K12D12.1 Source_evidenceePCR1170WS150 Sequence/Annotation Release
Chunk_score Abs_score1086
Max_abs_score1086K12D12.1
Specificity_index0.646
Rel_score1
Map_statusUnique_ePCRII1187499011876377
K08E5.1 Chunk_score Abs_score225
Specificity_index0.134
Rel_score0.207
F32A11.4 Chunk_score Abs_score197
Specificity_index0.117
Rel_score0.181
F32A11.5 Chunk_score Abs_score173
Specificity_index0.103
Rel_score0.159
Overlaps_transcriptK12D12.1 Source_evidenceePCR1170WS150 Sequence/Annotation Release
WB_DNA_textTH:201-a121388ttcaccgcgtttctttctctctttctcccgatcgtcctaaaattaaatgtcatctttttccagatctctaacaatgagcgactctgatagtgaattctctatcgaagattcacccaagaagaaaaccgcaccaaagaaggagaaggcgtcaccgaagaaaaagaaagatgatggttggttaatttgtagagtttcttgaatctaatttgcttcttttcagccaacgagtcgatggttatgactgaagaggaccgcaatgtgttcacgtcgatcgacaaaaaaggtggtggctcgaaacaaatggcgatcgaggatatctaccaaaagaagtcccaactcgagcacattcttcttcgcccggacacctacatcggttcggtcgagcataccgagaagacgccgatgtgggtctacaacatggaggagagcaagctggagcagcgtgacatctcatacgtgccgggactctacaagatttatgatgaaattcttgtgaatgccgctgacaacaaacagagagatccgaagatgaacacaatcaagatcaccatcaataagtaagtttagaccgtagcataaaggaatttaatttaattttgctttctttcagggagaaaaatgagatctctgtctacaacaatggcaaaggaatcccagtcactcagcacaaagtggagaaagtctacgtcccagagctgatttttggaactcttctaacatcttctaactacaatgacgatgagaagaaagtgacgggaggacgcaacggatatggagcaaagctttgcaacatcttctccacaaaattcactctggagacgtcttcacgggattacaaaagtgcattcaagcaaacgtggatcaaaaacatgacgcgtgatgaggagccgaagattgttaagagcaccgacgaagacttcacgaagatcacattctcgccggatctggcaaagttcaagatgaaggagctggacgatgacatctgccatttgatggctcggcgtgcgtatgatgtggctggatccagtaaaggagtcgccgtgttcctcaatggaaaacgaattccaatcaaaggattcgaggactacgtccaaatgtacacttcgcagttcaacaatgaaggagaacccctcaagatcgcatacgagcaagttggagatcgttggcaagtcgccttggctctttcggaaaaaggcttccaacaagtgtcatttgtcaacagtattgctaccacaaaaggaggacggcacgtggactacgtggctgatcagatggtcgccaagttcatcgactcgatcaagcggaagctcacaaagacgtcgatgaatatcaagccattccaggtaaatttcgtcgaatttaaaatatttaccgccaatgatgactca