Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:201-c2   

Cenix:201-c2RNAiCenix:201-c2
PCR_productcenix:201-c2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC26D10.1 Source_evidenceePCR1263WS150 Sequence/Annotation Release
Overlaps_Gene C26D10.1 Source_evidenceePCR1361WS150 Sequence/Annotation Release
Chunk_score Abs_score1277
Max_abs_score1277C26D10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII83228898324425
Overlaps_transcriptC26D10.1 Source_evidenceePCR1361WS150 Sequence/Annotation Release
WB_DNA_textTH:201-c21537aacaatcgaattggctaccgggaaacgaaaaaataacaaaataatgctacagagacaaaacaaaactgatataaaagttgagaataaaaccaaataatttaatttttcttggcaataatcaaagtgtgctgatcggaaatcgaagccccgataatcgaataaccgtcaagatgggcggagctgatctcctctggcttggacaccatctggaaaataagattgaatattttatttattgatagtttgagttttgaaaaattaccttctcgtcttcgtctttcaatccgagaccaagttgtccggtagtatcaaaaccccaagcgtaggcggttccatcctcagaccaggcgatagaagtggctagtttggcagaaacaccaacgatcttcgaatcgaattctatttcctggattgtatcgtacaaccaatgctgttggtcgtcctttccagtccaattaccgaggccgagagcattgtctgtgttctttcccatagcaaacacttttccatcacttccgagaatgacgacatgctggactccttcgatattaacgaatgttctttctgctccaaaagctggggcttctgctggaagaaaaacccgaagctcgcggttgtcctgtccgtcttgtccgacatcagcttcgtcaactttgataccgagttgagcatagttattgagtccgaaggcgtagtattttccgtcttctccgtggacaatagtccaaaatccactggcgaacacgtttttagcaacaacgtcaaagaactttcctttatgcttaaatctgaggggcacgagtaaatgatcaccagattcatcgcacatgtactctgaaataaaagtaatctgtgatgtattttgaaacattaattcataaaccaaacaaacttatgaaaaatctcacttgaacgaatagttttggtacgactactgcgtcctaactgtcccatttctccatcaccgaacgtgagaaggcagcccttctcatccaacatcacgagatggttctcgccagctgcgatcttcacaattttacgtttagcttggtggacaataaccaccggcgcttcttgcatcttatgaaggagtggatgaacatcaacgtttccattggagttgcgaagatttccccaggcaattacagatccttgatcagtgagagcagcggtaaacgaggctccagcggctagcattacaatctgaaataatatttgaatagaaacaataataagacagcatacaaacctttccttccttctcgatatcttcctcgaactttactttcgcaaactcgtcggtacttccttccttctctacaccttccgcgggaacagttcccttttcgttgataccgcacatataaacttcaccctcagaggtaagtactgctgagtgaactcctcctgcgacggcttgaagtggttttaaaccttcttcttcaaaaatatcaactttccgtggcttttttgtggtggttcttcctgggtgacccagagcttctccttctccgcacgacaaaactcgatcgccaat