Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:201-c7   

Cenix:201-c7RNAiCenix:201-c7
PCR_productcenix:201-c7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF22B5.7 Source_evidenceePCR1205WS150 Sequence/Annotation Release
Overlaps_Gene F22B5.7 Source_evidenceePCR1205WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRII84577538459050
Overlaps_transcriptF22B5.7 Source_evidenceePCR1205WS150 Sequence/Annotation Release
WB_DNA_textTH:201-c71298ttgggattatctggacgaggtggatatccttcccaaacttccaccgaacttcgatgagctgcgagaatccaaaaaatggcaggaacgaaaagaggcattggaagcacttctcaaagtactcacggacaatgagcgactttcaacaaaagcttcatatgccgaacttattggtcatctgcagatggttggttttcatatttttcggtcatttctgcaatctcattttacaggttctagcaaaagatgcaaacatcaattgccaagcgcttgcagccaaatgcatcggaaaattcgcaacgggattacgtgcaaaattctcttctttcgcaggaccacttcttcccgtcattttcgaaaaaatgaaagaaaagaagccgatgctccgagaacctcttgtagactgttccaatgaagtcggccgtacaatgcaatctttggaaactggtcaggaagacattttggcggcgctggccaaaccaaatcctcagatcaagcaacagactgcactttttgtggctcggcagttagatttggtggttccagcaaaacaaccaaaaggattcatcaaagctgttgtgcctgtgtttggaaaattgactggcgatgcagatcaagatgtcagagaggcatctcttcaaggtttaggagctgttcagcgcatcattggagacaaaaacgttaaaaatctcctcggcgatgcttcttccgatgaagggaaaatgaaaaagattggggaatatgctgaaaaatcaaccgctagcttcgcagaagaacaagctaaaaatgctccaccagtcgctcccacttcttcgacaccttcggcaagtgctgcttcgggagatccatccggcggaacagcaactgctgttgtttcatctggagctccagttgcggaagccgatccttgggattttcttgacgctttcgacgtactttccaaaatgcccgacggttttgataccaacatcgaaagcaagaaatggcaggaacgaaaagaagcgcttgaaggtttgcttcaattgatcacagcgaatccgaagctcgacccaaaggcaaactatggcgcactcgttgagagattgcagaaggtatgtgtattttgtcctgaaaaattattttaaattcaaatattaaggtcctcgagaaagatgcaaatatcaatgtggctgcactagcggccaattgtataactggtattgctaatggtctccgtacgaagttccagccgtttgctgtgtctgtgactccaatcatttttgagaagttcaaagagaagaaaccaactctacgtgatccgc