Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:201-g3   

Cenix:201-g3RNAiCenix:201-g3
PCR_productcenix:201-g3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene B0491.2 Source_evidenceePCR1012WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRII1133646911337756
Overlaps_transcript B0491.2.1 Source_evidenceePCR1012WS150 Sequence/Annotation Release
B0491.2.2 Source_evidenceePCR1006WS150 Sequence/Annotation Release
WB_DNA_textTH:201-g31288tgaacctaatgggaaaacgctcaaaaattgccgaaaaaacgcgacaaattctaaaaaaaaatctccaactttcagacaatttttttggtatttttttggaaaatttttctaaatttttaatcggaacaagctgaatctcaaatattttattagaaaacaccaacaatttagatatttctgtatccacggttggcgttgacagcctctgatggtggagacttgtctgggcactggcagtactcggcatcctttcctggtcttccgtctggtccagtctctccctgggttccgtctggtccttgacgtccttgctttccagatggtccttctggtccaacggttcctggctctcctggtggtccgtgaagaccgttctgtccagctggtcctgttggtccttgatctcctcttggtccctttggtcctggtcttccgattggatgctcggcgtcgcgtcccttctctcctggtggtcctggctctccgatctttccgatttgaccggatgatccttgctctcctggatgtcctggttgtccatctcttcctgggtttccattttgtcctcttggtcctggaagtccacgtggtcctggtcttccaagagctcctggtggtccaactggtccttgtgggcaagtgaagcatccgacagactcgcgttgtggagcgatatcatcagctccaactcctggaacaccgtcaagtcctggaactccgtcgagtcctggaactcctggaactccctttggtccggatggtccagctgggcacttgttatcagcattgcagttgcaggttggtccatttccattggctccatttggagtctttggctggttgaagactggtggaactgctggtggttgacctggtggagcagatggggatccatcagcatgtggagttggggtagcgttggtctcttcatattgacgacggacacgcttgctagatcttccgatgacaactatgtccttccacaatccattggtagattgctagaaaattaaaaattatttaaaattcaaaatataatttaactcactctgaacacattcatctcggtatcaagcttctctctgaatccatcaacctccgagtagatggttgacatggtcatgaagcataccataagagtggcgacagtgaccgaagccgtcacataacacgcaagttttacagacatctctgaaattatcaaatttaggatttcaaaataattcggccaaagaaatgtaactcacctagtcttcgagaagcagagacttgtcgatttcctaccgga