Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:202-g1   

Cenix:202-g1RNAiCenix:202-g1
PCR_productcenix:202-g1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K08F8.1 Source_evidenceePCR1328WS150 Sequence/Annotation Release
Chunk_score Abs_score1181
Max_abs_score1181K08F8.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII87454928747186
Overlaps_transcript (18)
WB_DNA_textTH:202-g11695tcgacgtgaagttgagttgcactggctgaccaatgcgcatgaaaatgtcgtttcgattcttgacatttatgaaaacacttttgacaatgtcaaatgtcttctgatggttgttgagtttttggaaggaggtgatttgctcagtcaattcgagagtcaaggaagcattccatatactgagaagagttagtttaaacaattatatcttccaaaattaatttcaattattttttcagaagttggtgaaattatccgccaaattggtaatgctgtgatgtaccttcacgacatgaatattgcacatcgggatatcaaacttgaaaacattttgtgtagtggtacgggtgacaattgtgtctataaattgggtgattacgggtttgccaagcgtccagagagaaatgtcctcatggagtcgccatgttgtactccgttctacgcgtaagttctagaatgttttgtcttctagattctataaatcttattttcagacctccagaagtattgggtcgtgaacgatatgacaagtcgtgtgacatgtggtctctaggagttgctatgtacatattgtaagttatcagtttcactttgcattgttcttgatttgaaaatagtaaaaaaatcgattttaaaattgatattcttatctattttttctatcagttaaaatcgaaacttttgtttgctcaaactatttctcttcgtatttttataaacaagaaattagtacaacaatttgaaattgaaaagaaaaacagggattccgaagcactctgaaccctattacagattatgcggatatccgcccttctactcgatgaaaggtgtcgctttgtctccgggcatgcgatcacgaattgccaatgcatattatgcgttcccacacgaggaatgggattgtgtgtcaaaagatagtaagcgcctagaaactaccgaatttcacgatttcagcacactaagaatctggtcgtgactaaccgaattcattacgcttccgatgactaactgataattgttttcagctaaggatgacattcgttgtttgttgcgtacaaatccaagtgatcgtctcactattcatgagctgatggcaacaccattggtaactggagaaccgattgtacctggaaaacacatcacaacagctattgccattcctggagctgatgagtccgagtgtggaggaggagttttcgatgacggatttattgttgaagaggaagaaactcctgatacggtacaaattaaaaaagctcaatttcaattcaagttttttcttctttcaggttgccgaaattcttccagtcccaaaaagtgtccgtttccttcgagacggtgtcaaggctccacgactccacagtatccaagaggaagttggtcgtgccatggaaattatgcgtatgggtactgatcaagtctacatcaagaatccaactgcctcatgcaacaacttgttcgagagacgtcgcgctgttcatttgagcattccacgtgtttactgctaatccataacctacctcaaaatatctcatttatatcaattcctgccatgctatatatttgactgaccaatcggttatatacttttcgattatttctttacataattttcttgtaaataatttgttttcatattatatgcacgtcgtaaatgaatcccctatcactatttccacaaacctattacaccattcgcgc