Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:202-g10   

Cenix:202-g10RNAiCenix:202-g10
PCR_productcenix:202-g10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C04A2.3a Source_evidenceePCR1571WS150 Sequence/Annotation Release
C04A2.3b Source_evidenceePCR1565WS150 Sequence/Annotation Release
Overlaps_Gene C04A2.3 Source_evidenceePCR1571WS150 Sequence/Annotation Release
Chunk_score Abs_score1508
Max_abs_score1508C04A2.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII68454946847157
Overlaps_transcript (5)
WB_DNA_textTH:202-g101664caacaccaccaccaactctgacaaatggtctcacaaatggtcatggtccagaatcttcgactccaaatggtgaaactatctcgaaaagaatgaaagtagaaccaagttatgacgatgatgacgatgaggaagaaggtaaaatgactattgatgaaggtgatgacgatccaatgccggtattaaatggattcaaaaaagaagaatcagttgaagagatcaagttagaacttaatggtacaattaaaaaggaaaacggcgtggaaaccgatcccacgacgcccacgtgctccatggaagctgaaaatgaagtatgtgaaacaccagctgttgtttcagtagaaattagagatgaaacaaatggcgaaacgaattcggatctaaaagacgatgaaaacgtggagcctgacagcccagaagacactttcgaattgggaagcaacgtggaatttgaaacaaaaaatgcgatgtttgttcgttcgattgttagatcttgtggtcctcggtgtgcacgaaccgatttaattttcaaaataaaagttggtggcgtgtgggagaagagcatcaaagaaaaggaggagaggaagaaggttcatctccaaaatcaacgaattcaagactctgaaaaagttgcaattcaacaaaatcagatcaagaaagaacaacaacagtctcaaccgactccacaacaaatccaccagcagcaagctcagcaaaatgctcaacatctgcaacaacttcaacaggctgtgatgttggggcatcttcctcctgaagttcttcgtcaaatgatgcctccacaatttggtgtggatcctacagcaatattaatgcaacagatgatggctggtcagcaatctcaaggagttaatgcagcattccaacatcaaatggctcttcaacaacaacttgaagctcatcaagttcaggtacgtattccacaatcattagtttattataattttgttatagtttcagcttatgatggctcatcaacatcaacaaaaaatgatagctgaacaacagcaacagcaaagacatgctgcagcgcagcaattgcgagaacgggagcaacgtgaacaacgtgaacgagaaagagaacgacaacatcaacaacaggctcaacaagctcttcatcagcaacaacaacagcatgcggctgctgcagcgaatcaattgaatccagcaatgatgcagatgatggcattaatggcgaacagcgcagccagccaacaagatattgcacgattaatggagatggctgctcagcagcaacaacagcaacagcaagctgctcaggctcaagcccagcgtgaccaagaacgtgaacgacgggaacgtgaagcacgagaacgggaagctgctcgggaacgtgaacgagagcaagctgctcgagaagctgcagcacgagatcaggcagcccgcgaacatgctcaagcagttcaggcagcagcagcagcagcacaacaggcacaggcacttgtgagtcttaacttttgctaatggtcatataaattttgttaatatttcagacacctgatatgcaacatatgcatctactgcaacagttgatgctaaatccagcacttatgatgcaacttcaacaggctcaagctcaacaacaacaacaacagcctcaagtaacgaatccccttcaaatgttgcag