Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:203-b12   

Cenix:203-b12RNAiCenix:203-b12
PCR_productcenix:203-b12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC54A12.2 Source_evidenceePCR735WS150 Sequence/Annotation Release
Overlaps_Gene C54A12.2 Source_evidenceePCR735WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRII52534645254988
Overlaps_transcriptC54A12.2 Source_evidenceePCR735WS150 Sequence/Annotation Release
WB_DNA_textTH:203-b121525gaaaaatgttgaggcggtgtgaatgataatgaggtagttaaaaatttctccaagcatttctagataaatattctgaaattgtacagctcaaataaaaattaaacagattttagctacctgaattgttagaaactttccaacaaaactctccgcaagctttagggccattgagaagaagtggcagaatccaaagaaaattgtgataaccagaagcattactgtcgtattttgctctttttgttgttgaattgtcatcaaacttctttcctttttcgttcttctcagctcgctgataatcaacatattcgcaacaaacatgatcacaaatggaacgagataatcgaatataatagaaatgatgatgaaataaaacatgaagtaccaccaatgtttctcagaatccagaagatcccgtctgaagaatgccaaaccatcgatgtattcaatttcaaattcaaagaatcgagcaaaattcagaaccactgcgaaagtgatgatggcggcgatggagtatgatgatgtggtgtatcgacaccagatttggacctggaaaattaaaaaataaatagagaaagctggaattttaagctgcagttttttcggataattttttattgattttttttggaaccatacaattatttatccttcgtttaacaattcattaatttttcgtgaaattattcgaaatagattcaggtcaccacattttccatgtaatttcaaaaagtaacccctggcgacaaaaatctatttccctgttttcagaaaaatttggtaaggtccattttacccggatattttaaaagttaagtagtacctcaagtggtcgacaaacagcaatccatcgctcaatagtaatcaataccataatataaagactgcatgtttttgccatcatacacaacggatatacatatttagcagtgtacgcgacgacgaaacttctctgctcgtcagtcctgaaattaaataatgtgattagaataatatgttttttaatttcatgtaactccataggtcatcctgaacacatcataatttcctcccacttccttctgcaataaccttaacactttttctcgcatttgtgaaagaaaagcgcgcaatatcttattttccttcctgacgtgctttcgctcatcttgtgtgcaaatgagatgtgtgtgggtatgcgtaacactttccaatttcacacccacaaaaccttaccaaatgggtagatacatgatgctgaaaagtggaagagcgaagactagcaggaagatgtcagagacggacagtgagtacagcaggaaaccgacctgcaaaaataacaattttacaggaaacatgattcttagtcttgggatttcaacttggaacatgttttttttaaccatatgttcttactaaatctttagatggccagtttgaactagaaaaaagtcgatctgaaaaatttcaggcaatttttttcatagtaaaatagctttgttagaaaagttgtttttcaatcctcaaatcgattttaggattttggcga