Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:203-d3   

Cenix:203-d3RNAiCenix:203-d3
PCR_productcenix:203-d3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C32D5.9 Source_evidenceePCR429WS150 Sequence/Annotation Release
Chunk_score Abs_score387
Max_abs_score387C32D5.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII63471906347767
Overlaps_transcript C32D5.9.1 Source_evidenceePCR429WS150 Sequence/Annotation Release
C32D5.9.2 Source_evidenceePCR427WS150 Sequence/Annotation Release
WB_DNA_textTH:203-d3578tcggcggataatacatgacactttattccttcttttcgacctctcctccatacacactttcgtcactgtaggcgatgtaaaggaacaagtcttcctcgtgatggtcctgtaataaagaaaagggttaattaaatgaaaataaacgactggttagttacctggtagagttgtcccattgtggtcatggtttgtggaatgacattgttgacaaagaagaacagagcatcttctggacgaagttggatgcgttttctgatgaggaagtagaactgtccaacagtaagatcggatgggaccaagtacttcttcttatccaagtcatggagctttgactttggtgctttctcaacaatcactggaatacggtctgggtactttctgcggatcttgtctccttcggcacgacgcttctcaaagttgttctcctccttgtaagcccacttcattttgattcgaaggttagtgtgaagagaaggttactggaataaaaatactttaaatcacagaaaaatcataaaagaaccatgagagaagaaaggtgtaacaagtgagagtgaatgaaggtgacatcacatggg