Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:204-d5   

Cenix:204-d5RNAiCenix:204-d5
PCR_productcenix:204-d5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF18A1.3b Source_evidenceePCR37WS150 Sequence/Annotation Release
Overlaps_Gene F18A1.2 Source_evidenceePCR1065WS150 Sequence/Annotation Release
Chunk_score Abs_score913
Max_abs_score913F18A1.2
Specificity_index0.856
Rel_score1
Map_statusBest_ePCRII76820847683368
F18A1.3 Source_evidenceePCR584WS150 Sequence/Annotation Release
Chunk_score Abs_score374
Specificity_index0.144
Rel_score0.168
Map_statusTop50_percentile_ePCRII76820847683368
Overlaps_transcript (7)
WB_DNA_textTH:204-d51285tttttcaccggaggaagatgtaatgacaactttatgattcttcatggctttcacttgtcgacgtcttcccattgtcttccattcatctttcgtcatctcttcatatttcactcaatcactgccttgtgcgatcatgtaatttcaaactattgtaattcgttgaaattatcaaataataaatttaatcaggttattattgaatgtttatgtaacctattccatctcacaatgagttaatacaactcttgaatacttgaataccttcatccctcgcttactttttttaaaatttttaattgattattttcagatgctttctaaatttgtggtagtcgaagtaagcaactcaaataacacaatgacactggtggaatacttggtatgtttatcatttaaaaagttcgattaacattggtattttcaggtaacgcatggattcgacaagtttgcagttgtaacagatttagttgatcacccttctttcaagtacaaggatggttcatcaagtcccgaatctccatcaacaactgcttcaactgctgcccaacacacaccaccacgaacagcagtttcaacacctacatccatcaacactccagttccaccacatcaaaacaaacagaggcattcaattgacaaaatcgctgcaaatttatccaccaaaaaggtttcaccatcatctattgagaagcagctccaaagaacatctcataatcctcttcatcaactatctaccccacatgcattgagtcaactacagaaattgctggaggagcagcacaagattaatcagatgaatattcagaaaaaggaacaggagaggcagcaagctgagattcaaagaattctgctccaacaggcaaatgctgctcagattaatcactcatttggattagaaaggctaacaccagaatatgatgataatcatcatagtgaaacaatatctaaagctagctctgaagatttgaagactgagcccgattcaactgattttgggcttggaacaagcgacgatcaagtacgtgcttcaatgcttcatctgcttcatccagtatttgctccagcttttgggatgcttgatgccgagaatatctttggagctgcatcaaaaccaacgacgcctgcatcaaaacgacgaaacactgattcaaatggtgctccatcgaaaaaacatcgttggctcccagtcaatgagcttgaagagagtcgatcatcgcgaggaaagaactgcggaagagttcattgcaaggccacctacaagtgtgcactctgtggaaagccaaca