Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:205-a10   

Cenix:205-a10RNAiCenix:205-a10
PCR_productcenix:205-a10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK09F6.5 Source_evidenceePCR1233WS150 Sequence/Annotation Release
Overlaps_Gene K09F6.5 Source_evidenceePCR1233WS150 Sequence/Annotation Release
Chunk_score Abs_score1191
Max_abs_score1191K09F6.5
Specificity_index0.668
Rel_score1
Map_statusUnique_ePCRII22718182273489
F54H12.2 Chunk_score Abs_score412
Specificity_index0.231
Rel_score0.346
Y57G11C.21 Chunk_score Abs_score180
Specificity_index0.101
Rel_score0.151
Overlaps_transcriptK09F6.5 Source_evidenceePCR1233WS150 Sequence/Annotation Release
WB_DNA_textTH:205-a101672gaatcataggaaggaggccccgcgccccgcccctggggttttcaagaagttgaaaatctgaatgatgatacattcaaagctatttgaagtttttcgataaagggttctccaccctttatcgaaaactttaaagagcaaggcttccttacaaacatgttttacattttatattatttattcaattacagacaaggccaagtattagttttacatgcattattccacaatcaatcaaaagataacaattaaacaatactgtcaacaatagggttacgcataaagtctagggcaaatatttgatcaaattcggcgtagacgatgcagtagagacctcctggtggagtttcctttttgaaattgaggcgtacgctaacgtttgtttgacgaactagttcgaaaagattattatcctgagccacagggctcaactcgaatccaaaaatcgtgtatcctttagatctgaacattcaaatgtcgatcgaattgcagctaaagttgtttctagtgtgaccaagtgtttcctgaagttgaacgtaggcctccacaaacttgttattctcaaagtctagattcattggtcgtcctggaattgtttgaccgcaataatcaatgtgaacgtcctgcacgccatatggtttgaagttgaacggagttgttccgaatgatccgttgtaagcttcgcttgaaactagacccagaaagagtcgacgaggcattttactagtgaacaacgtatttgcaggggcgtcaaaccgccctccatcaatgtagcaactgcgaacttgtgaggaaatcattgggtattggatcatcttgtgttcaatgattgcagcctccaactcgtttgacaaaccatctgttagatcaaactcattaacaagagcgtaaacatcagtaacgttgaatttgaacttttgttgaccatgattgtaagcctcaatcaaaaattcactattgtttgggtatgcagttagcttcacgttgcacgagtttagcaaaacccgtggttgattcatcaaatcgagagaaatgttcgcggcaacttgcgttgtacctgtaccacatcgattaaggaatcccttacttgtcggagagccaatttcatcttcgtggaaatatccagccgcagtgagagtagagtttttaatttcttttccatacattagtgcattctcaaaatatgccttgtaagcatagtttgaagagttgtgataagccagtcgcgagttgatgtgaagagaaaagtttttcacaatagagtgagctatattgttgattggggcgtaaaccaaactatctttagtgatgggattaggtatattcacaatagctccgttttgatcggtaatattaaaggtgtagactagataggttcgcttgagattgagataagatcttgaactgttgcccagtacaaactcccaaggaccttcggcttgaaacgcatttttcaagttgacaacagtccaacgagagttttgaatacaggtttgagtaccgggcattgtggaaaaatctagatcatcaacgatgacgtcatgagattttggatccatacggccaatcatgtttagagaaagttgtttcgtgatttggaaagcaaatgaggtttgattactcaaacactagtttcttttatgctttttcttctctgacccgaaccagaaatttc