Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:205-e12   

Cenix:205-e12RNAiCenix:205-e12
PCR_productcenix:205-e12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF58A6.8 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene (32)
Overlaps_transcriptF58A6.8 Source_evidenceePCR458WS150 Sequence/Annotation Release
WB_DNA_textTH:205-e12712tcaaagcagtggtgcaaaagtaaatcaagtgcaaagttcaatcaagcatgtgggtgtaccgaaattgtgcttctccaggcattcaaaatcagaaaagttgaactaaggccttcttactctcaaggcaaacattttttttcaaattgatgaacaaaaacacataatcagagaacgatttattagaggattcagaggagatggtcttatgggttgtactcaattgggaggttcttgcgacgaaccataccgtctccttggaaccattcacggcggaattgcttggcagctccatccggggtattggtccactcaacggtgatacggtcgttgtttgtatcctcctgaccgaaggcaaaggcatcacaggaaactgccagaagaactgcctcctttgggtccaaaactccacatggtggatcaactccaagtctcttcatattggtggtcttgataccgtatccaatacggcgagccgaggagttaatcactttgatgtgatacgtgtgcttgtcgtcgtatggtgcattgaagacgatcttcgtacccggctgggtctggatgtctcctggtgggacggattgggccatggcgacttctttgtagagtgtgaaaactcacagtgaagattatggcaaaacctgctcaatttatagcaaatttctctcttatctctgtcctagatctatagcaaacaacgtgaggtcatttcacg