Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:205-h1   

Cenix:205-h1RNAiCenix:205-h1
PCR_productcenix:205-h1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F32A5.1a Source_evidenceePCR680WS150 Sequence/Annotation Release
F32A5.1b Source_evidenceePCR680WS150 Sequence/Annotation Release
Overlaps_Gene F32A5.1 Source_evidenceePCR899WS150 Sequence/Annotation Release
Chunk_score Abs_score857
Max_abs_score857F32A5.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII72546077255878
Overlaps_transcript F32A5.1a Source_evidenceePCR899WS150 Sequence/Annotation Release
F32A5.1b Source_evidenceePCR680WS150 Sequence/Annotation Release
WB_DNA_textTH:205-h11272ttagaaactctcggcgcaatttgttctttagaagaagttaaagagctcagaagtgcatatcctcgtctacttcatgaaagtggtgtatcaaagtcggaaactcgtccaaaaatgagaagaagtgatgagttgaaaattcttggatacaataacgaacgtgaagaattggagtgtgaatggttcaatgaagctgaacaacttatcagtcgcctcacaatatctgctacggaacctcagaaagatcagagactcgatatggaaaatgatattaagttcgcccgtttgagacattacgttcgtctactcggaattcggaaggctaaacgaaatactgtgcttgaacatgacaagataaatgaattcatgaaattctaccaagaagcatgctacgcagcagccaaacgtccagtgagccagcaggagataatggattcacgtactgaaaaggagaagctattggcaatgactcaacaattcctgactagagacgagtatcgtagcctacgagcatccattgaacgtatcgataatgtagtggaacggatcgaagtacttcaggatcttcagaaaaacggtattaaaatttttatttatattaaaatcaatttaaaatgaacaattttctttagaaaaaaacatgacaactttgtcctattgaaaattcataaataccgtttgaaattcttattattattttatttttcaggcgagaccactctcaagaatgctccagttgaacgcaaatcgaagaaaaagatgagaaaaatcgattgtgaacagaagaaaaagattgctaccgaatggagcaagtttaaaaagtggcacactgaaggatgggagtaattttatctcgtattcgattacctatttataacatattattattaattttccccgtctctgtttgtcatatttattttcactttctaattcatttccatcccttgattctctaactcattacaagctctgtacaattatacaattactccaccgtcaaaaatctgtattatgttttttttttcataatttcatttggtcctaatacatgtcttctcaaccttatcagactgttcacttgtttactcaaacaaaaactcgtcatctcctaggagcacaaaaactgagtcacagaatggagacattgtaaaaatacaatatacaaattgtttgctccttttacaacgagacgcagagacaggacagtctccgtttcgcaaggacactcggaagatggcagtcgggtctctctctcacctctctcgttttgcc