Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:207-d9   

Cenix:207-d9RNAiCenix:207-d9
PCR_productcenix:207-d9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC30B5.1 Source_evidenceePCR761WS150 Sequence/Annotation Release
Overlaps_Gene C30B5.1 Source_evidenceePCR822WS150 Sequence/Annotation Release
Chunk_score Abs_score717
Max_abs_score717C30B5.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII61986096199692
Overlaps_transcriptC30B5.1 Source_evidenceePCR822WS150 Sequence/Annotation Release
WB_DNA_textTH:207-d91084gggtgattccaaacagcattgtgcgcgcgctacttttaaaaatttttcatttgtcatcaacaaatttgcttgatcaatcttgtgctatcccattttttctattttgtttaagttaaatttcatgaattgaaaactatgaacaaggacaattctccctccgaaagtctcgttaactcgagtgcttcggaagataaaaccgtgaagacttcaatgagcgccaataatccttcaataaatggtatctttagttttatttaaaatttatggataaattttatttactttcagatagctcactcccagaaagattgcctgccatgtgtggatgtgattctcaaaatcgggaagaatctgcaaactccggagttcaactatcggtttgtgattgaatgaagagaaaaatgcataatttttgtttttaggatcatgcgaacgagtccctatcgaaacaagctgatgacgttatatatgagggcgggctggaagataaagattcagtattccgtgcaattattgaagacgatgatgcttgcgaagtattagatgatggaatcgataattgcgaagtggaagtgcgaggaattaaatatagagtgcgatctagagctcataactttttttgcaaattttatttttagattccagtagctatcgagtgtcacctctgcaatgaaatgatgaacttgtgtttgaggagaactcgttatcgtggacaagcacgcgaatacccagcataccgctgcaaccgcaaaggatgccaaacatttcgatccattagaaaagtattcgggaattgtatgtcagatgtcgataattctggcgatgctacaactcgtactatgatttatcatccaccacataaagttcgaaaaacttcacctggagagttttctgatgatggtaacgaataacacttgagaacataattacattattttcatatttcagatagcaaagagtttgttgttcaacgcgtctatataccaaaaattgataatcggaataaggatcagtcggtcaagtctttatcggtcaccgaccgaatgagaaaggcgaaccaggatcgtgcgattgtcttctcaga