Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:209-b6   

Cenix:209-b6RNAiCenix:209-b6
PCR_productcenix:209-b6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T01E8.6 Source_evidenceePCR494WS150 Sequence/Annotation Release
Chunk_score Abs_score431
Max_abs_score431T01E8.6
Specificity_index0.876
Rel_score1
Map_statusUnique_ePCRII1024000910241702
B0047.1 Chunk_score Abs_score61
Specificity_index0.124
Rel_score0.142
Overlaps_transcript T01E8.6.2 Source_evidenceePCR399WS150 Sequence/Annotation Release
T01E8.6.1 Source_evidenceePCR494WS150 Sequence/Annotation Release
WB_DNA_textTH:209-b61694aagacatccttgattgccgaaaaataaaacgtttgaatttttaggcttttgccgccaattaactaacgagacccattgtattggggctgtggagcacgctcgcacactgatggacagaaaaacatctgaaaataataatttttctgaaaaaaaagtattttaattgatcaataaccaatacagagatatcataatctatatcacaataaaacaaaaataattcattaagagcatcgataacaaaagaagtgttcaaaacgaagaagaaatcaaaaatagaaaacaaataaatctaaaactacaactcctatctcacactaccacatggctctttggactccactgagagctgatctatctgcaaatcgacggaacaagtgtctactcaatctgtatggctttatctttccacgttgtcgtcctgtgaactggcacatattgagaatcagacgaggatgatcgtattttcgagctttttgcattttctcggctgcttcgtcacgaatcgcttgcgggagaattgtgttgaatttgatagcttttagacgcatacgatccgcgccgacttcctgaaattaaattttaatcaagggcaagcagcaggcctgggcttgtttaaggcttttttgtcaaaaatgggggtgtcgggggttttttgttacaaaaatgggttttttctggtttttttggtttgtgggggtttttttaataaaaaagggaattttttggttttttcgtcacaaaaaatggttttttttttgggttttctgttttgtggggttttgtttttttaaaaagtaatgattttcaataacgattttttggtggttttcgaataaaaaaaatatttaaaaaatttcagacatgtgaaaagaagcgaaaaacttttttttgtttatggaaaattttttttggtgacagccctggtgttttttggtattctggcacgaagaaaaatgcgattttttttttgtattttaaacaatttatattttgtaaatattcttatggtttttgatgttttttagctctgtcggtagtggtggccgctagcagtctggaggtcacgagttcaagtccggcctcaccccctaggttcacccagcctctattgggaagtggagcaatccacgactggattatcggccacagtccccggctaggacgtggcttaaattacagcccagagggatcaccaccaggcagtgtacctgaatcccagatccgcagtgcatagcacttgaagaacggatcgtcctttaatcctttaatcctttaaaacaaattttttggcacatatgacaatattcgtattttttggtattttttgttttggttcttttacaaatttcaatttttttcctttttggtttgaaataaaaaccaaaaatatttttagcacatatgacaatattcgtataaaaaatagaaaccaacctgaatctgctcacgtcgtttgacatctctcaactgacgccaactcgcccagaatgtcattcgttttccggttttccaccattctctctccacgtatctatagaaacgtatattcaatacaagtgtatagtttatgtgcaattctttctcactttgagaataaaaaagcggcaggcaataatttcaaaaatatacaaaaaaaaccaaaaacctacaatggatactgatcaagtttcaattttgtaagcgcctcgcta