Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:209-h10   

Cenix:209-h10RNAiCenix:209-h10
PCR_productcenix:209-h10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS ZK970.2 Source_evidenceePCR246WS150 Sequence/Annotation Release
ZK970.3 Source_evidenceePCR474WS150 Sequence/Annotation Release
Overlaps_Gene ZK970.2 Source_evidenceePCR281WS150 Sequence/Annotation Release
Chunk_score Abs_score197
Specificity_index0.332
Rel_score0.497
Map_statusTop50_percentile_ePCRII1030008110301866
ZK970.3 Source_evidenceePCR501WS150 Sequence/Annotation Release
Chunk_score Abs_score396
Max_abs_score396ZK970.3
Specificity_index0.668
Rel_score1
Map_statusBest_ePCRII1030008110301866
Overlaps_transcript ZK970.3 Source_evidenceePCR501WS150 Sequence/Annotation Release
ZK970.2 Source_evidenceePCR281WS150 Sequence/Annotation Release
WB_DNA_textTH:209-h101786ctacgacatcggccaaaaattgaagccatcgctcgttagattaaaacagagaaatttttggaaaaacaactagggattaccatgagattgtttcgtgtgaaattatcgtcattttatgggaaggcgggagagagattaacttacttatcatttgatataatctatcaattgtattgcttaagttatcacaaataagagaatgtagtcaagaacaatagactgtgcaaagaaaaaaagatagaaaaaagtatgtacccgaataatctagattaaatttaaactccgcccaaattgttcatcttcttcttcttcttcttcttcctgctcaaacttcttcttgttgccacctaccaattagcaatatgacaaattacacgtgacgtcagccacgtcacattccttcttcctgcgggagcagcatgatgtgctctgggagccgatgtgacgtcacaggtcaaggagagtaacagagtttttgagagggatcagagagatcgacggcttgaagttgcaaaatatcacgtattacaaagtggaacaccgattttttgttgttaagaaatttatgatctttcaatggaaattcaaatacaaaaaagagaataagaagaaatcgtctactaaacttcaattatgcactaaaaatacacatattttaatctgatggcattgatccgttgtgagtctcgatttggtcgaccaatccgaacttgagagcttcgtgggcgctcatgaaacgatcacggtcaagggttttctcaatttcctgaaataaatattcatttttccaattaaaagtgaactcgcactcacatcataactcattcccgtgtggtgaacataaatttcgttgagtcttctcttcagacgagtaatttcttcggcacgaatgactatgtccgagcaggttccctgcaagaaaaaaaaaatttgaatttgcgccaaaaaatgaagaaatgtgtgcaattgcgcgtggtggtgtacctggtacaccgtcacgtcacattgcggactgccgagaatagaattaaattgaatctgtttattttttgttttacaactatttaacttatttaaaatgtctggagtagctggtggtgcatctaaaaagagtagtagccgtactatggctacaaagaagctaattattgacgtaagttattaattttatgatcagaaaagagtgtttaattttccgatttttctaggaattcaaaagaaggcttcgagataatatcaaatcattaaacgacaacttttttcacattattcaagctgccaaggtcaacccagatgacaacgcctacaaaaatcaaacgggaaaaatgaccgaattctatacaacaaaaaatgagatggcagttcgtgcgcaactcatggtatttgtttttttcattttgtattaataaaatacaatttttcaggttcgtgcttcagatgagctattaaaactgacggctgatctcaaagaatttctgattctccacgattttcactttttgacgcataacatcaagcagtaagtgatcgtaatcatttgattaaatgtaaaatggaatttttcagagctgaagcacaatgcgaagaaacattgcgtcaacaatctcatcagcacaactgtctcgattcggaagtgagcaatattctattcgatctggaacgcgaaatcgcggaaaatttctatcttcgtcatacctaataaatacgatccctcttgtgtaataatttgttcatgtgtttatcaatttacctgtgcaccaccactcggctggtgaaccatgattct