Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:21-b8   

Cenix:21-b8RNAiCenix:21-b8
PCR_productcenix:21-b8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC14A4.2 Source_evidenceePCR675WS150 Sequence/Annotation Release
Overlaps_Gene C14A4.2 Source_evidenceePCR675WS150 Sequence/Annotation Release
Chunk_score Abs_score633
Max_abs_score633C14A4.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1058111110581836
Overlaps_transcriptC14A4.2 Source_evidenceePCR675WS150 Sequence/Annotation Release
WB_DNA_textTH:21-b8726tttcgagacgatccaattcccagttagcagatgttggaactctttccgaaattgagatgccagttgccaaacagcttaatatgagaaatcatctgccagctccactttctaaacagatggatacgttgggagaagttgttaccttggttagtcggcgataatcaatggaatattatattcaataaatatattttcagatccgagaaccaatggcagaagtagcaagctgtatgcgagttgtggataaaagtcttccagctcttcgcctcgtgttatggggagctttcggaaccggaaagtcggttactctcaatcaagctgttcatcatgcttataataataaatgggcaattgttcatctaagaagtgcaatggagctgacaagaagagtaaaagaaattgagatgtcatcttttgtacaaggccgtatcaatgatccatcgaattctgtttctattctccaaaatttcaagcaacaaaaccaacatatctggaagattctcggagagttgctcactgaaagagattatgaatggtcgaaaagtgaacgaacgttgaaaggaaaacctatcactgaaattattgaaatgggaatctctgctccgttccttgccagtgattgtgttggtgcaatcttccgagagctccgacgccacgcaaaagatgacaaactgaaggttctagtggcgattgatgatgcgaattctctgtggggaaaaactttgg