Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:21-d8   

Cenix:21-d8RNAiCenix:21-d8
PCR_productcenix:21-d8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C47E12.1 Source_evidenceePCR605WS150 Sequence/Annotation Release
Chunk_score Abs_score542
Max_abs_score542C47E12.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1000373310004435
Overlaps_transcript C47E12.1.3 Source_evidenceePCR605WS150 Sequence/Annotation Release
C47E12.1.2 Source_evidenceePCR605WS150 Sequence/Annotation Release
C47E12.1.1 Source_evidenceePCR605WS150 Sequence/Annotation Release
WB_DNA_textTH:21-d8703tcgacattgacatgttccgtactgaaaagggtaagtgtcaatcattaaaaacattgccaacagttgaaaaacagtatcgaagttaaggtggaaacccagaaatcattcgtaagtcgcagcaggaccgtttcaaggatccgaagttggtcgacgaagtgattgaattggatgagaaatggagaaaggagagatttgtggctgatcaacttaatcgccagaagaatgctatttctaaagctattggggagaaaatgaaggtcagttaactctaacttgtgtcaaccaaagatttttttagaagaaggaaccacaaggaacagacgattccgttgctgatgacattgtcgcacgtcttgctgaattgaaaattgatgagctgtctcagttaaccgttgttcaactgaaaaagctcagagtccttgtcgatgagaagtctgttcaaactgcagctgccgtcatcgccaacgaaaatgcacgccatgagaagctcattcaaatcggaaacttgattcactctagtgtcgtcgtatcaaaagatgaagctaacaacaaaattgagagaactttcggagatttaagcaccaagaagaagtattcacacgttgatttggttgtgatggttgatggctttgatggagagcgcggaacagttgttgctggaggtcgtggatatttcttgaagggcccacttgtcttcttggag