Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:211-a6   

Cenix:211-a6RNAiCenix:211-a6
PCR_productcenix:211-a6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW05H5.6 Source_evidenceePCR205WS150 Sequence/Annotation Release
Overlaps_Gene W05H5.6 Source_evidenceePCR205WS150 Sequence/Annotation Release
Chunk_score Abs_score184
Max_abs_score184W05H5.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1245435612454833
Overlaps_transcriptW05H5.6 Source_evidenceePCR205WS150 Sequence/Annotation Release
WB_DNA_textTH:211-a6478tgatcttgaagctccccaacttaatttactatttttagaaacccatttctcattggcttaaccgcaatgttgagcattccgcagtggaaagagcaatttatgaagtcatttttgacggtacggttgttcagaaatagacgaaaacctgtgcatattgtcgtggaaattgaggagtgtgcgaaaaagaagaacgatgtggagactaatttatattttaagcaattggcgaattcttggatttgaattattttttttttgttggaacatttgtatttttgaagaattaataaatacacgtggtgtcaggctgccgcattacagcttgatctacaaaaaatgcgggaatatttttccagaaaaattgtgacgtcagcacgctcttaaccatgcaaaatcagatgagatgtctgcttctcaacttccgcattttttgaagagcaaaaatatcgaagtccacatgttcaatggagcgcactta